Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Melibe leonina mle-miR-279-3p URS00000D08A0_76178

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUAGAUCCACACUCAUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Apis mellifera ame-miR-279d-3p
  2. Blattella germanica Bge-Mir-279-o36_3p (mature (guide))
  3. Centruroides sculpturatus Csc-Mir-279-P14b_3p (mature (guide))
  4. Daphnia magna Dma-Mir-279-o6_3p (mature (guide))
  5. Daphnia pulex (common water flea) dpu-miR-279a
  6. Dinoponera quadriceps dqu-miR-279b-3p
  7. Eisenia fetida (common brandling worm) Efe-Mir-279-o18_3p (mature (guide))
  8. Heliconius melpomene hme-miR-279a
  9. Ixodes ricinus iri-miR-279a-3p
  10. Ixodes scapularis (black-legged tick) isc-miR-279
  11. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-279-P10_3p (mature (guide))
  12. Lottia gigantea lgi-miR-279
  13. Manduca sexta (tobacco hornworm) mse-miR-279a
  14. Parasteatoda tepidariorum (common house spider) pte-miR-279-3p
  15. Penaeus japonicus miR-279
  16. Tribolium castaneum (red flour beetle) tca-miR-279b-3p
  17. Triops cancriformis tcf-miR-279a