Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Heliconius melpomene (postman butterfly) hme-miR-279a URS00000D08A0_34740

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACUAGAUCCACACUCAUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Apis mellifera ame-miR-279d-3p
  2. Blattella germanica Bge-Mir-279-o36_3p (mature (guide))
  3. Centruroides sculpturatus Csc-Mir-279-P14b_3p (mature (guide))
  4. Daphnia magna Dma-Mir-279-o6_3p (mature (guide))
  5. Daphnia pulex (common water flea) dpu-miR-279a
  6. Dinoponera quadriceps dqu-miR-279b-3p
  7. Eisenia fetida (common brandling worm) Efe-Mir-279-o18_3p (mature (guide))
  8. Ixodes ricinus iri-miR-279a-3p
  9. Ixodes scapularis (black-legged tick) isc-miR-279
  10. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-279-P10_3p (mature (guide))
  11. Lottia gigantea lgi-miR-279
  12. Manduca sexta (tobacco hornworm) mse-miR-279a
  13. Melibe leonina mle-miR-279-3p
  14. Parasteatoda tepidariorum (common house spider) pte-miR-279-3p
  15. Penaeus japonicus miR-279
  16. Tribolium castaneum (red flour beetle) tca-miR-279b-3p
  17. Triops cancriformis tcf-miR-279a