Tupaia chinensis (Chinese tree shrew) tch-miR-499a-5p URS00000C7662_246437

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 16 other species
• 44 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUAAGACUUGCAGUGAUGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

1. Alligator mississippiensis (American alligator) ami-miR-499-5p
2. Bos taurus bta-miR-499
3. Callithrix jacchus cja-miR-499a
4. Canis lupus familiaris cfa-miR-499
5. Capra hircus chi-miR-499-5p
6. Equus caballus eca-miR-499-5p
7. Homo sapiens hsa-miR-499a-5p
8. Ictalurus punctatus ipu-miR-499
9. Macaca mulatta (Rhesus monkey) mml-miR-499-5p
10. Monodelphis domestica mdo-miR-499-5p
11. Mus musculus mmu-miR-499-5p
12. Pongo pygmaeus ppy-miR-499-5p
13. Pteropus alecto (black flying fox) pal-miR-499a-5p
14. Rattus norvegicus (Norway rat) rno-miR-499-5p
15. Sus scrofa ssc-miR-499-5p
16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1658060

Publications Download

• FASTA
• JSON