v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-455-v1_5p (mature (guide)) URS00000AD002_9371

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUGUGCCUUUGGACUACAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus (domestic cattle) Bta-Mir-455-v1_5p (mature (guide))
  2. Callithrix jacchus cja-miR-455
  3. Canis lupus familiaris cfa-miR-455
  4. Capra hircus (goat) chi-miR-455-5p
  5. Cavia porcellus cpo-miR-455-5p
  6. Cervus elaphus cel-miR-455
  7. Cricetulus griseus (Chinese hamster) cgr-miR-455-5p
  8. Dasypus novemcinctus dno-miR-455-5p
  9. Equus caballus (horse) Eca-Mir-455-v1_5p (mature (guide))
  10. Homo sapiens hsa-miR-455-5p
  11. Loxodonta africana (African savanna elephant) Laf-Mir-455-v1_5p (mature (guide))
  12. Macaca mulatta mml-miR-455-5p
  13. Mus musculus (house mouse) mmu-miR-455-5p
  14. Nomascus leucogenys nle-miR-455
  15. Oryctolagus cuniculus ocu-miR-455-5p
  16. Pongo abelii (Sumatran orangutan) Pab-Mir-455-v1_5p (mature (guide))
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-455-5p
  18. Rattus norvegicus rno-miR-455-5p
  19. Sus scrofa ssc-miR-455-5p
 Relationships

Molecular Relationships