Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-455-5p URS00000AD002_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-455: mmu-mir-455 is a microRNA (miRNA) that has been identified in mouse models and is implicated in the regulation of various genes and biological processes [PMC4356433]. Research has shown that mmu-mir-455, when elevated in cardiomyocyte-derived exosomes (CM EXOs), can inhibit the activation of matrix metalloproteinase 9 (MMP9), thereby protecting against fibrosis and myocyte uncoupling in the heart [PMC6406975]. In a study involving mice subjected to destabilization of the medial meniscus (DMM), those injected with mmu-mir-455 agomir exhibited significant alterations in cartilage OARSI grade scores and collagen II content, suggesting a role for mmu-mir-455 in cartilage homeostasis [PMC7658376]. Additionally, mmu-mir-455 was found to be differentially expressed in lung pathology models, indicating its potential involvement in lung disease processes [PMC3030602]. The miRNA has also been associated with regulatory networks involving genes such as motile sperm domain containing 1 (MOSPD1) and reticulon 4 (RTN4), highlighting its role in gene regulation [PMC3742134]. The presence of mmu-mir-455 was first recorded in miRBase v8.1, indicating its recognition as a significant miRNA for further study [PMC3125744]. Quantitative analysis of this miRNA can be performed using specific TaqMan RT-PCR assays, facilitating research into its expression and function [PMC4386824].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUGCCUUUGGACUACAUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Bos taurus (domestic cattle) Bta-Mir-455-v1_5p (mature (guide))
  2. Callithrix jacchus cja-miR-455
  3. Canis lupus familiaris cfa-miR-455
  4. Capra hircus (goat) chi-miR-455-5p
  5. Cavia porcellus cpo-miR-455-5p
  6. Cervus elaphus cel-miR-455
  7. Cricetulus griseus (Chinese hamster) cgr-miR-455-5p
  8. Dasypus novemcinctus dno-miR-455-5p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-455-v1_5p (mature (guide))
  10. Equus caballus (horse) Eca-Mir-455-v1_5p (mature (guide))
  11. Homo sapiens hsa-miR-455-5p
  12. Loxodonta africana (African savanna elephant) Laf-Mir-455-v1_5p (mature (guide))
  13. Macaca mulatta mml-miR-455-5p
  14. Nomascus leucogenys nle-miR-455
  15. Oryctolagus cuniculus ocu-miR-455-5p
  16. Pongo abelii (Sumatran orangutan) Pab-Mir-455-v1_5p (mature (guide))
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-455-5p
  18. Rattus norvegicus rno-miR-455-5p
  19. Sus scrofa ssc-miR-455-5p
Relationships

Molecular Relationships

Publications