v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS00000ABDA6_9940

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGUUUGUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis ami-let-7i-5p
  2. Capra hircus (goat) let-7i
  3. Cyprinus carpio ccr-let-7i
  4. Gallus gallus (chicken) gga-let-7i
  5. Gorilla gorilla gorilla ggo-let-7i (MIRLET7I)
  6. Gorilla gorilla ggo-let-7i
  7. Monodelphis domestica (gray short-tailed opossum) mdo-let-7i-5p
  8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72640
  9. Sarcophilus harrisii (Tasmanian devil) sha-let-7i
  10. Xenopus laevis xla-let-7i-5p
  11. Xenopus tropicalis (tropical clawed frog) xtr-let-7i
 Relationships

Molecular Relationships