Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-let-7i URS00000ABDA6_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-let-7i: Gga-let-7i is a microRNA (miRNA) that has been identified as potentially having a tumor suppressive function in chickens, as its downregulation is associated with tumorigenesis [PMC5065965]. This miRNA, along with gga-let-7b, is implicated in the regulation of multiple signaling pathways, including MAPK, TGF-beta, Notch, Wnt, mTOR, Cell cycle, P53, and Jak–STAT pathways [PMC9201442]. Bioinformatic analyses suggest that gga-let-7i may be targeted by various circRNAs and could be involved in complex regulatory networks influencing these signaling pathways [PMC9504570]. The expression of gga-let-7i has been detected alongside other miRNAs in studies examining miRNA profiles [PMC3406056]. The aberrant expression of gga-let-7i along with other miRNAs has been linked to the presence of the retrovirus ALV-J and its associated tumorigenesis in chickens [PMC5276853].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGUUUGUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis ami-let-7i-5p
  2. Capra hircus (goat) let-7i
  3. Cyprinus carpio ccr-let-7i
  4. Gorilla gorilla gorilla ggo-let-7i (MIRLET7I)
  5. Gorilla gorilla ggo-let-7i
  6. Monodelphis domestica (gray short-tailed opossum) mdo-let-7i-5p
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72640
  8. Ovis aries miscellaneous RNA
  9. Sarcophilus harrisii (Tasmanian devil) sha-let-7i
  10. Xenopus laevis xla-let-7i-5p
  11. Xenopus tropicalis (tropical clawed frog) xtr-let-7i
Relationships

Molecular Relationships

Publications