Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-217 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-217 precursor URS0000060B2B_9597

110 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 6 other species
54 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AGUAUAAUUAUUACAUAGUUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGAUAAGAAUCAGUCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Gorilla gorilla gorilla ggo-mir-217 (ENSGGOG00000036138.1, ENSGGOG00000037150.1)
Gorilla gorilla microRNA ggo-mir-217 precursor
Homo sapiens microRNA hsa-mir-217 precursor
Pan troglodytes (chimpanzee) ptr-mir-217 (ENSPTRG00000027795.2)

Publications