Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide)) URS0000028BBC_8478

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-203-3p
  3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
  4. Cyprinus carpio ccr-miR-203a
  5. Danio rerio dre-miR-203a-3p
  6. Gadus morhua gmo-miR-203a-3p
  7. Gallus gallus gga-miR-203a
  8. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
  9. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-203
  10. Latimeria chalumnae Lch-Mir-203_3p (mature (guide))
  11. Lepisosteus oculatus (spotted gar) Loc-Mir-203-v1_3p (mature (guide))
  12. Maylandia zebra mze-miR-203
  13. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
  14. Monodelphis domestica (gray short-tailed opossum) mdo-miR-203
  15. Monopterus albus Mal-Mir-203-P1-v1_3p (mature (guide))
  16. Neolamprologus brichardi (lyretail cichlid) nbr-miR-203
  17. Ophiophagus hannah (king cobra) oha-miR-203-3p
  18. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
  19. Oryzias latipes (Japanese medaka) ola-miR-203
  20. Paralichthys olivaceus (Japanese flounder) pol-miR-203-3p
  21. Petromyzon marinus (sea lamprey) pma-miR-203b-3p
  22. Python bivittatus pbv-miR-203-3p
  23. Salmo salar (Atlantic salmon) ssa-miR-203a-3p
  24. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
  25. Sphenodon punctatus (tuatara) Spt-Mir-203_3p (mature (guide))
  26. Taeniopygia guttata tgu-miR-203-3p
  27. Takifugu rubripes (torafugu) fru-miR-203
  28. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
  29. Tor tambroides miR-203a-3p
  30. Xenopus laevis xla-miR-203-3p
  31. Xenopus tropicalis (tropical clawed frog) xtr-miR-203
Relationships

Molecular Relationships