v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-miR-203a-3p URS0000028BBC_8030

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAAAUGUUUAGGACCACUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-203-3p
  3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
  4. Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide))
  5. Cyprinus carpio (common carp) ccr-miR-203a
  6. Danio rerio dre-miR-203a-3p
  7. Gadus morhua gmo-miR-203a-3p
  8. Gallus gallus (chicken) gga-miR-203a
  9. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
  10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-203
  11. Latimeria chalumnae (coelacanth) Lch-Mir-203_3p (mature (guide))
  12. Lepisosteus oculatus (spotted gar) Loc-Mir-203-v1_3p (mature (guide))
  13. Maylandia zebra mze-miR-203
  14. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
  15. Monodelphis domestica mdo-miR-203
  16. Monopterus albus Mal-Mir-203-P1-v1_3p (mature (guide))
  17. Neolamprologus brichardi (lyretail cichlid) nbr-miR-203
  18. Ophiophagus hannah oha-miR-203-3p
  19. Ornithorhynchus anatinus (platypus) Oan-Mir-203-v1_3p (mature (guide))
  20. Oryzias latipes ola-miR-203
  21. Paralichthys olivaceus (Japanese flounder) pol-miR-203-3p
  22. Petromyzon marinus (sea lamprey) pma-miR-203b-3p
  23. Python bivittatus (Burmese python) pbv-miR-203-3p
  24. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
  25. Sphenodon punctatus Spt-Mir-203_3p (mature (guide))
  26. Taeniopygia guttata tgu-miR-203-3p
  27. Takifugu rubripes (torafugu) fru-miR-203
  28. Tetraodon nigroviridis tni-miR-203
  29. Tor tambroides miR-203a-3p
  30. Xenopus laevis (African clawed frog) xla-miR-203-3p
  31. Xenopus tropicalis xtr-miR-203
 Relationships

Molecular Relationships

 Publications