Bos indicus x Bos taurus (hybrid cattle) microRNA 450a-2 (ENSBIXG00005023968.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos indicus x Bos taurus (hybrid cattle) microRNA 450a-2 (ENSBIXG00005023968.1) URS000075ECE3_30522

92 nucleotides
1 database (Ensembl)
Found in 7 other species
3 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAAAGAAAGAUGCUAAACUAUUUUUGCGAUGUGUUCCUAAUAUGUAAUCUAAAUGUAUUGGGAACAUUUUGCAUUCAUAGUUUUGUAUCAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Bison bison bison microRNA 450a-2 (ENSBBBG00000000515.1)
Bos grunniens (domestic yak) microRNA 450a-2 (ENSBGRG00000024365.1)
Bos mutus (wild yak) microRNA 450a-2 (ENSBMUG00000008219.1)
Bos taurus microRNA bta-mir-450a precursor (bta-mir-450a-2)
Ovis aries (sheep) miRNA (ENSOARG00000024451.1)
Tursiops truncatus microRNA 450a-2 (ENSTTRG00000022334.1)

Publications