Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1248 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1248 precursor URS000075EAF7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1248: MIR1248 is a microRNA that may target a specific isoform of OGG1 due to differences in mRNA 3′UTR regions [PMC9118907]. In stallion sperm, MIR1248 is one of six miRNAs that show very high expression levels [PMC3569414]. It has 154 target genes and is upregulated in SK-N-SH and K562 cells [PMC5600530]. The relationship between PSMD10 expression levels and MIR1248 has been investigated [PMC9414407]. In TamR cells, MIR1248 is slightly upregulated with moderate absolute expression levels, along with other miRNAs [PMC3402532]. In old hematopoietic stem cells (HSC), MIR1248 has been found to be regulated along with an inflammation mediator NFKBIA [PMC8296523]. After IFN-γ stimulation, MIR1248 is one of the top 10 upregulated miRNAs [PMC8010072]. MIR1248 is a microRNA that may target a specific isoform of OGG1 due to differences in mRNA 3′UTR regions. The majority of miRNAs (76%) showed high expression level (10 AC 100), 13 miRNAs (16%) had AC lower than 10, whereas 6 miRNAs-MIR34B, MIR34C, MIR191, MIR223, MIR1248, and MIR1905C-showed very high expression levels (AC≥100) in stallion sperm. It has been found to have 154 target genes and be upregulated in SK-N-SH and K562. The relationship between PSMD10 expression levels and MIR1248 has been investigated. In TamR cells it was found to be slightly upregulated with moderate absolute expression levels along with other miRNAs. In old HSC, MIR1248 has been found to be regulated along with an inflammation mediator NFKBIA. After IFN-γ stimulation, MIR1248 is one of the top 10 upregulated miRNAs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUACCUUCUUGUAUAAGCACUGUGCUAAAAUUGCAGACACUAGGACCAUGUCUUGGUUUUUGCAAUAAUGCUAGCAGAGUACACACAAGAAGAAAAGUAACAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

2D structure Publications