Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-365b precursor URS000075E397_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR365B: MIR365B is a microRNA gene located within the NF1 microdeletion region, which is associated with neurofibromatosis type 1 (NF1) and tumorigenesis [PMC5370280]. Patients with NF1 microdeletions are hemizygous for MIR365B, along with other genes such as NF1, SUZ12, ATAD5, and MIR193A [PMC5370280]. The loss of MIR193A and MIR365B genes in patients with NF1 microdeletions may contribute to tumorigenesis in these individuals [PMC5370280]. While the role of SUZ12 loss in malignant peripheral nerve sheath tumor (MPNST) progression is well-documented, less is known about the involvement of ATAD5, MIR193A, and MIR365B in MPNST pathogenesis [PMC5370280]. The 1.4-Mb NF1 microdeletion region contains four microRNA genes: MIR193A, MIR365B, MIR4725, and MIR4733 [PMC5370280]. RT-qPCR analysis has been performed to study gene expression using TaqMan assays for validation purposes [PMC8278229]. Several miRNAs including miR-4262, miR-506-3p, and MIR365B have been identified as tumor suppressors targeting GALNT4 [PMC8504460]. Drosha cleavage activity has been detected over intronic regions of genes such as CTDSP1 and long noncoding RNA (lncRNA)-derived genes like MIR193A and MIR365B using POINT-5 analysis [PMC8122139]. ATAD5 along with other genes like miR193A and miR365B have been identified as having tumor suppressor activity within the NF1 microdeletion region [PMC8395254].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGUGUUCAAGGACAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAGUGUGCAUCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

Publications