Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR399b-5p URS000075E239_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-mir399b-5p: Zma-mir399b-5p is a microRNA (miRNA) in maize that plays a crucial role in the regulation of fatty acid metabolism and transportation [PMC6214007]. This miRNA is one of the differentially expressed miRNAs (DEMs) that, when decreased in expression, leads to the upregulation of genes involved in fatty acid biosynthesis, thereby enhancing lipid transfer to arbuscular mycorrhizal (AM) fungi [PMC9499406]. Zma-mir399b-5p is part of the larger miR399 family, but it is not accurate to state that all twelve members are implicated in the regulation of fatty acid metabolic processes without specific evidence for each [PMC6214007]. The downregulation of zma-mir399b-5p has been observed in maize studies, which indicates its potential regulatory function [PMC6214007]. Furthermore, zma-mir399b-5p targets and controls the expression of genes such as Zm00001d003797, a root r-b1-like gene [PMC6214007]. Additionally, this miRNA interacts with long non-coding RNAs (lncRNAs) like MSTRG.15598.1 and MSTRG.15598.3, which are involved in gene regulation mechanisms within the plant [PMC8756644].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAGCUCUCCUCUGGCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications