v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-301b-3p URS000075D98F_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGUGCAAUAGUAUUGUCAAAGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis (American alligator) ami-miR-301a-3p
  2. Bos taurus bta-miR-301a
  3. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-1009248
  4. Callorhinchus milii Cmi-Mir-130-P2b_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-130-P2b_3p (mature (guide))
  6. Cavia porcellus cpo-miR-301a-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-130-P2b_3p (mature (guide))
  8. Columba livia cli-miR-301a-3p
  9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-301a-3p
  10. Drosophila erecta Drosophila_erecta piRNA piR-der-181316
  11. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21106873
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P2b_3p (mature (guide))
  13. Gadus morhua Gmo-Mir-130-P2b1_3p (mature (guide))
  14. Homo sapiens Hsa-Mir-130-P2b_3p (mature (guide))
  15. Latimeria chalumnae Lch-Mir-130-P2b_3p (mature (guide))
  16. Macaca mulatta Mml-Mir-130-P2b_3p (mature (guide))
  17. Monodelphis domestica Mdo-Mir-130-P2b_3p (mature (guide))
  18. Monopterus albus (swamp eel) Mal-Mir-130-P2b2_3p (mature (guide))
  19. Mus musculus Mmu-Mir-130-P2b_3p (mature (guide))
  20. Ornithorhynchus anatinus Oan-Mir-130-P2b_3p (mature (guide))
  21. Oryctolagus cuniculus (rabbit) ocu-miR-301a-3p
  22. Pteropus alecto (black flying fox) pal-miR-301a-3p
  23. Rattus norvegicus (Norway rat) Rno-Mir-130-P2b_3p (mature (guide))
  24. Sarcophilus harrisii Sha-Mir-130-P2b_3p (mature (guide))
  25. Scyliorhinus torazame Sto-Mir-130-P2b_3p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-130-P2b_3p (mature (guide))
  27. Taeniopygia guttata (zebra finch) Tgu-Mir-130-P2b_3p (mature (guide))
  28. Xenopus laevis (African clawed frog) Xla-Mir-130-P2b4_3p (mature (guide))
  29. Xenopus tropicalis Xtr-Mir-130-P2b_3p (mature (guide))
 Publications