Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1290 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1290 precursor URS000075D458_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1290: MIR1290 is an exosomal miRNA that has been studied in various contexts. In the context of colorectal adenoma (CRA), MIR1290 levels were found to be a significant discriminating factor in identifying CRA in patients [PMC8116025]. In the context of non-alcoholic fatty liver disease (NAFLD), a miRNA panel that included MIR1290 showed high diagnostic accuracy [PMC5910543]. In melanoma cells, MIR1290 was found to be downregulated by POL treatment, and its downregulation promoted melanoma-cell autophagy by regulating the expression of BECN1 [PMC5604572]. MIR1290 levels were also found to be increased in primary melanoma tissues compared to adjacent normal tissues [PMC5604572]. Additionally, MIR1290 has been studied in the context of HIV-1 replication and as a potential marker for early diagnosis of necrotizing enterocolitis (NEC) [PMC9237370] [PMC9523100]. Furthermore, MIR1290 has been implicated in muscle atrophy and as a potential circulating biomarker for pancreatic cancer diagnosis [PMC7958887] [PMC6219528]. The role of MIR1290 in melanoma and ovarian cancer is still not well-studied compared to other tumors, but it has been shown to have oncogenic functions in other human tumors such as gastric cancer and esophageal squamous-cell carcinoma [PMC5604572] [PMC8928998]. The expression levels of MIR1290 have also been associated with SARS-CoV-2 infection and hypoxia-associated extracellular vesicles (EVs) in melanoma patients with poor prognosis. Additionally, it has been reported that combining the expression levels of MIR1290 with CA19-9 improves the effectiveness for selecting patients at risk for pancreatic ductal adenocarcinoma (PDAC) [PMC10057657] [PMC5465008].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGCGUCACGUUGACACUCAAAAAGUUUCAGAUUUUGGAACAUUUCGGAUUUUGGAUUUUUGGAUCAGGGAUGCUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications