Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-106a precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-106a precursor URS000075D3AB_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGUCAAAGUGCUAACAGUGCAGGUAGCUUUUUGAGUUCUACUGCAGUGCCAGCACUUCUUACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications