Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Danio rerio (zebrafish) microRNA dre-mir-454a precursor secondary structure diagram

Danio rerio (zebrafish) microRNA dre-mir-454a precursor URS000075D385_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-454a: Dre-mir-454a is a microRNA (miRNA) in zebrafish that has been evaluated for its stability as a reference gene in gene expression studies [PMC8613261]. According to the Normfinder software analysis, dre-mir-454a ranked as the third most stable miRNA with a stability value of 0.014, suggesting its potential utility as an endogenous control [PMC8613261]. However, when expression data from methimazole (MTZ) treatments were considered, dre-mir-454a's stability ranking dropped slightly to the seventh position with a value of 0.018 [PMC8613261]. Additionally, when comparing across three different zebrafish strains, dre-mir-454a's ranking was fourth in terms of stability with a value of 0.026 [PMC8613261]. The study investigated nine miRNAs including dre-mir-454a for their suitability as endogenous reference genes, indicating the importance of selecting stable reference genes for accurate normalization in gene expression analysis [PMC8613261].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCAGGUCGUUUAAGAAUUAAUCCUAAUUCUUGGGACCCUAUCAGUAUUGCCUCUGCUGUCCACUGUGUUCAGAGUAGUGCAAUAUUGCUAAUAGGGUUUUAGGUUUUAGGUUGUACCUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications