Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1271 precursor URS000075C9F1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1271: MIR1271 is a tumor suppressor in hepatocellular carcinoma (HCC) [PMC7425487]. A negative correlation has been established between FOXK2 mRNA and MIR1271 in HCC patient samples [PMC6468357]. MIR1271 directly regulates CCNG1, a master tumor suppressor [PMC5772750]. In various tumors, MIR1271 also directly regulates LDHA, along with miR-200c, miR-449a, miR-30d-5p, miR-142-3p, and miR-383 [PMC9742379]. Bioinformatics analysis of the MIR1271 gene has identified genehancers using the genehancer v4.8 database [PMC8454712]. Additionally, in osteoarthritis (OA) progression, circSERPINE2 functions as a competing endogenous RNA (ceRNA) of MIR1271 to regulate the anabolism of the extracellular matrix (ECM) [PMC7393488].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCCAGAUCAGUGCUUGGCACCUAGCAAGCACUCAGUAAAUAUUUGUUGAGUGCCUGCUAUGUGCCAGGCAUUGUGCUGAGGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications