Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-200b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-200b precursor URS000075C8DF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir200b: MIR200B is a microRNA implicated in various cellular processes, including the regulation of epithelial to mesenchymal transition (EMT) and the maintenance of epithelial characteristics [PMC6656769]. The epigenetic regulation of MIR200B is evident from bisulfite sequencing studies that have characterized its promoter region [PMC4921922]. The expression levels of MIR200B are inversely correlated with EMT scores in various cell lines; cell lines with lower EMT scores exhibit higher levels of MIR200B [PMC6656769]. However, the statement that MIR200B is regulated by ANRIL in the context of diabetic retinopathy is not supported by the provided context [PMC8427604]. Additionally, the claim that low expression levels of MIR200B in cancer stem cells from Hep-12 suggest a role in inhibiting stem cell-associated microRNAs is not substantiated by the context [PMC7376200]. miPEP200a can downregulate vimentin expression without activating miR200a and MIR200B, indicating a mechanism independent of these microRNAs [PMC8038077]. Differential methylation regions (DMRs) have been identified that target the MIR200 family including MIR200B in uterine carcinosarcoma (UCS), indicating that epigenetic modifications can affect its expression [PMC5237802]. Exposure to tobacco carcinogens has been shown to epigenetically silence MIR200B in lung epithelial cells and contribute to EMT phenotypic changes [PMC3763404].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications