Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) gmo-let-7d-5p URS000075C7A7_8049

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUUGGUUGUAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Brachionus plicatilis Bpl-Let-7_5p (mature (guide))
  2. Danio rerio dre-let-7d-5p
  3. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7d
  4. Ictalurus punctatus (channel catfish) ipu-let-7d
  5. Lepisosteus oculatus (spotted gar) Loc-Let-7-P1b_5p (mature (guide))
  6. Maylandia zebra (zebra mbuna) mze-let-7d
  7. Monopterus albus (swamp eel) Mal-Let-7-P1b2_5p (mature (guide))
  8. Mus musculus Mus_musculus piRNA piR-mmu-49317872
  9. Neolamprologus brichardi (lyretail cichlid) nbr-let-7d
  10. Oreochromis niloticus (Nile tilapia) oni-let-7d
  11. Paralichthys olivaceus pol-let-7d-5p
  12. Pundamilia nyererei pny-let-7d
  13. Salmo salar ssa-let-7d-5p
  14. Takifugu rubripes fru-let-7d
  15. Tetraodon nigroviridis tni-let-7d
  16. Tor tambroides let-7d-5p