Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Heterocephalus glaber (naked mole-rat) microRNA 26a-2 (ENSHGLG00000022749.2) URS000075C1BF_10181

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUUGAUUACUUGUUUCUGGAGGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Ailuropoda melanoleuca microRNA 26a-2 (ENSAMEG00000021820.2)
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000012556.1)
  3. Balaenoptera musculus microRNA 26a-2 (ENSBMSG00010011108.1)
  4. Bison bison bison microRNA 26a-2 (ENSBBBG00000013186.1)
  5. Bos grunniens microRNA 26a-2 (ENSBGRG00000009581.1)
  6. Bos indicus x Bos taurus miRNA (ENSBIXG00000003611.1, ENSBIXG00005000573.1)
  7. Bos mutus (wild yak) microRNA 26a-2 (ENSBMUG00000025409.1)
  8. Bos taurus microRNA bta-mir-26a precursor (bta-mir-26a-2)
  9. Callithrix jacchus (white-tufted-ear marmoset) microRNA cja-mir-26a precursor (cja-mir-26a-2)
  10. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000033040.1)
  11. Castor canadensis (American beaver) miRNA (ENSCCNG00000031205.1)
  12. Catagonus wagneri (Chacoan peccary) microRNA 26a-2 (ENSCWAG00000006157.1)
  13. Cebus imitator (Panamanian white-faced capuchin) microRNA 26a-2 (ENSCCAG00000004099.1)
  14. Cercocebus atys miRNA (ENSCATG00000019730.1)
  15. Chlorocebus sabaeus (African green monkey) microRNA 26a-2 (ENSCSAG00000027765.1)
  16. Equus asinus asinus microRNA 26a-2 (ENSEASG00005007453.1)
  17. Equus asinus (ass) microRNA 26a-2 (ENSEASG00005007453.2)
  18. Equus caballus (horse) microRNA eca-mir-26a precursor
  19. Erinaceus europaeus (western European hedgehog) microRNA 26a-2 (ENSEEUG00000016003.1)
  20. Gorilla gorilla gorilla microRNA 26a-2 (ENSGGOG00000032759.2)
  21. Homo sapiens microRNA hsa-mir-26a precursor (hsa-mir-26a-2)
  22. Loxodonta africana (African savanna elephant) microRNA 26a-2 (ENSLAFG00000023807.1)
  23. Macaca fascicularis microRNA 26a-2 (ENSMFAG00000013429.2)
  24. Macaca mulatta microRNA mml-mir-26a precursor (mml-mir-26a-2)
  25. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000024623.1)
  26. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000009565.1)
  27. Meriones unguiculatus miRNA (ENSMUGG00000008084.1)
  28. Microcebus murinus (gray mouse lemur) microRNA 26a-2 (ENSMICG00000018375.3)
  29. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 26a-2 (ENSNLEG00000026125.2)
  30. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017526.1)
  31. Ovis aries microRNA mir-26a (MIR26A)
  32. Pan paniscus (bonobo) microRNA 26a-2 (ENSPPAG00000015014.1)
  33. Pan troglodytes ptr-mir-26a-2 (ENSPTRG00000027700.2)
  34. Papio anubis miRNA (ENSPANG00000018939.3)
  35. Phocoena sinus microRNA 26a-2 (ENSPSNG00000007425.1)
  36. Pongo abelii miRNA (ENSPPYG00000021449.2)
  37. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-26a precursor (ppy-mir-26a-2)
  38. Prolemur simus microRNA 26a-2 (ENSPSMG00000020760.1)
  39. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000001976.1)
  40. Pteropus vampyrus (large flying fox) microRNA 26a-2 (ENSPVAG00000025348.1)
  41. Rattus norvegicus (Norway rat) microRNA 26a-2 (ENSRNOG00000047216.2)
  42. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 26a-2 (ENSRFEG00010000453.1)
  43. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000016265.1)
  44. Spermophilus dauricus miRNA (ENSSDAG00000002277.1)
  45. Sus scrofa (pig) microRNA ssc-mir-26a precursor
  46. Theropithecus gelada (gelada) microRNA 26a-2 (ENSTGEG00000019143.1)
  47. Tursiops truncatus (bottlenosed dolphin) microRNA 26a-2 (ENSTTRG00000023650.1)
  48. Urocitellus parryii microRNA 26a-2 (ENSUPAG00010017718.1)