Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1908 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1908 precursor URS000075C0B7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir1908: MIR1908 is a micro-RNA encoded by the MIR1908 gene located on chromosome 11 and is implicated in various biological processes and diseases [PMC9469614]. It has been identified as a potential biomarker for prostate cancer, with lower expression in tumor tissues compared to normal tissues, suggesting a role as a proliferation suppressor [PMC5696163]. MIR1908 has been associated with the activation of the AKT pathway in neuronal models, although this relationship was not observed in HuH-7 liver cancer cells [PMC8660805]. Additionally, MIR1908 expression appears to be regulated independently of the FADS1/2 loci despite their genomic proximity [PMC8660805]. The gene has also been linked to bipolar disorder (BD), with significant associations found after correction for multiple testing [PMC9547016]. Functional analyses have suggested that certain genetic variants within MIR1908 may alter its secondary structure and potentially its function [PMC9547016]. Despite these associations, further research is needed to fully understand the biological mechanisms and clinical significance of MIR1908.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGAAUGCCGCGGCGGGGACGGCGAUUGGUCCGUAUGUGUGGUGCCACCGGCCGCCGGCUCCGCCCCGGCCCCCGCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications