Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-98 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-98 precursor URS000075BF40_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir98: MIR98 is a microRNA implicated in the regulation of breast cancer metastasis, as evidenced by in vivo experiments where MDA-MB-231 breast cancer cells, infected with a lentivirus carrying MIR98, were inoculated into the mammary fat pads of nude mice and stimulated with CCL18 [PMC4653020]. This microRNA was among seven selected for validation of array-based expression data using Taqman quantitative RT-PCR, highlighting its significance in the study [PMC3288043]. Furthermore, MIR98 is involved in a regulatory pathway where its expression is increased upon the silencing of N-Ras, leading to the inactivation of the ERK/PI3K/NFκB/Lin28b pathway and loss of its inhibitor Lin28b; this upregulation of MIR98 contributes to further inhibition of N-Ras expression [PMC4653020].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications