Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-138 precursor (hsa-mir-138-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-138 precursor (hsa-mir-138-1) URS000075BD79_9606

  • 99 nucleotides
  • 7 databases (ENA, Ensembl, GeneCards, HUGO Gene Nomenclature Committee, MalaCards, MIRBASE, RefSeq)
  • Found in 1 other species
  • pre_miRNA
Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir138-1: MIR138-1 is a micro-RNA encoded by a specific genomic locus on chromosome 9, distinct from its homolog MIR138-2, and is implicated in various biological processes [PMC6836737]. It is expressed in the nervous system and has been identified as one of the brain-enriched microRNA-coding long non-coding RNAs (lncRNAs) [PMC4468152]. Notably, MIR138-1 does not appear to be associated with a deficit in Schwann cell (SC) differentiation, as indicated by studies on MIR138-1 conditional knockout (cKO) nerves [PMC5830491]. In the context of ischemic chronic heart disease (iCHD), Mendelian randomization analysis has identified DNA methylation levels at two CpG sites near MIR138-1 that may exert causal effects on the disease [PMC8501606]. Additionally, this micro-RNA is situated in an intergenic region with no other nearby annotated miRNAs or mRNAs, suggesting a unique regulatory role [PMC4057207]. Research using Bru-seq technology has revealed that the primary transcription start site (TSS) for MIR138-1 may be located significantly upstream from its annotated mature DNA sequence [PMC4675984]. Furthermore, quantitative RT-PCR results support an accumulation of miRNA 5′ leader sequences relative to primary miRNA for MIR138-1, indicating post-transcriptional regulatory mechanisms at play [PMC4057207].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGGCAUGGUGUGGUGGGGCAGCUGGUGUUGUGAAUCAGGCCGUUGCCAAUCAGAGAACGGCUACUUCACAACACCAGGGCCACACCACACUACAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression