v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-191 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-191 precursor URS000075BBD9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir191: MIR191 is a microRNA (miRNA) that has been identified as notably expressed across various tumor types and is considered a key miRNA ortholog among those that are mutually abundant in these tumors [PMC9210832]. In the context of malignant hyperthermia (MHT), the concentration of MIR191 in patients may serve as a valuable biomarker, potentially aiding in the decision-making process regarding the necessity for an initial cranial computed tomography (CCT) scan [PMC7430915]. Research has also been conducted on modified peptide nucleic acids (MEPNAs) for MIR191, with four different MEPNAs being synthesized, each with varying gap sizes of unmodified nucleotide units, to explore their potential applications [PMC4005664].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aotus nancymaae microRNA 191 (ENSANAG00000002056.1)
  2. Cebus imitator (Panamanian white-faced capuchin) microRNA 191 (ENSCCAG00000019836.1)
  3. Cercocebus atys (Sooty mangabey) microRNA 191 (ENSCATG00000016956.1)
  4. Colobus angolensis palliatus miRNA (ENSCANG00000015560.1)
  5. Gorilla gorilla gorilla microRNA mir-191 (ENSGGOG00000032588.2)
  6. Macaca mulatta (Rhesus monkey) microRNA mml-mir-191 precursor
  7. Macaca nemestrina microRNA 191 (ENSMNEG00000003434.1)
  8. Mandrillus leucophaeus microRNA 191 (ENSMLEG00000011577.1)
  9. Nomascus leucogenys microRNA 191 (ENSNLEG00000019430.2)
  10. Pan paniscus microRNA 191 (ENSPPAG00000005153.1)
  11. Pan troglodytes ptr-mir-191 (ENSPTRG00000027820.2)
  12. Pongo abelii miRNA
  13. Pongo pygmaeus microRNA ppy-mir-191 precursor
  14. Rhinopithecus bieti microRNA 191 (ENSRBIG00000000315.1)
  15. Rhinopithecus roxellana microRNA 191 (ENSRROG00000038234.1)
  16. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 191 (ENSSBOG00000009241.1)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Expression Publications