v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-211 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-211 precursor URS000075B6A0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir211: MIR211 is a cellular microRNA that has been implicated in the regulation of cell cycle progression in human osteosarcoma cells, where its overexpression has been observed to increase the percentage of cells in the G0/G1 phase and decrease the percentage in the S phase [PMC6617937]. This microRNA, along with others such as miR28, miR29b, miR138, and miR326, was selected for study due to its potential complementary target sequence within the HIV-1 genome [PMC3256098]. Additionally, MIR211 is known to be upregulated in various tumors including gliomas; however, its downregulation has been associated with increased sensitivity of glioma cells to temozolomide (TMZ), a chemotherapeutic agent [PMC7732422].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCACCUGGCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUUCGCCUAGGGCUCUGAGCAGGGCAGGGACAGCAAAGGGGUGCUCAGUUGUCACUUCCCACAGCACGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla microRNA 211 (ENSGGOG00000034479.2)
  2. Pan paniscus microRNA 211 (ENSPPAG00000018531.1)
  3. Pan troglodytes ptr-mir-211 (ENSPTRG00000027771.2)
 Relationships New

Molecular Relationships

 2D structure

Loading 2D structure...

 Expression New Publications