Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apteryx owenii (little spotted kiwi) miRNA (ENSAOWG00000007548.1) URS000075B1C0_8824

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUGAGGUAGUAGGUUGUAUAGUUUUAGGGUUAUGCCCUGCCUGUCAGAUAACUAUACAAUCUACUGUCUUUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Accipiter nisus (Eurasian sparrowhawk) microRNA let-7a-3 (ENSANIG00000014990.1)
  2. Amazona collaria microRNA let-7a-3 (ENSACOG00000001938.1)
  3. Anas platyrhynchos (mallard) microRNA let-7a-3 (ENSAPLG00020006118.1)
  4. Anas platyrhynchos platyrhynchos (common mallard) microRNA let-7a-3 (ENSAPLG00000000306.2)
  5. Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000002339.1)
  6. Anser brachyrhynchus microRNA let-7a-3 (ENSABRG00000006337.1)
  7. Anser cygnoides miRNA (ENSACDG00005014414.1)
  8. Apteryx haastii miRNA (ENSAHAG00000009112.1)
  9. Apteryx rowi (Okarito brown kiwi) miRNA (ENSARWG00000005725.1)
  10. Aquila chrysaetos chrysaetos microRNA let-7a-3 (ENSACCG00020008517.1)
  11. Athene cunicularia (burrowing owl) microRNA let-7a-3 (ENSACUG00000005243.1)
  12. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000014016.1)
  13. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000005492.1)
  14. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000008756.1)
  15. Calidris pugnax miRNA (ENSCPUG00000003422.1)
  16. Calidris pygmaea miRNA (ENSCPGG00000012099.1)
  17. Chrysolophus pictus miRNA (ENSCPIG00010009315.1)
  18. Dromaius novaehollandiae (emu) miRNA (ENSDNVG00000001568.1)
  19. Falco tinnunculus miRNA (ENSFTIG00000009834.1)
  20. Gallus gallus let-7a-3 stem-loop (gga-let-7a-3)
  21. Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000106.2)
  22. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000015569.2)
  23. Numida meleagris microRNA let-7a-3 (ENSNMEG00000015509.1)
  24. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000007135.1)
  25. Pavo cristatus (Indian peafowl) miRNA (ENSPSTG00000013236.1)
  26. Phasianus colchicus microRNA let-7a-3 (ENSPCLG00000008559.1)
  27. Strigops habroptila microRNA let-7a-3 (ENSSHBG00005005885.1)
  28. Strix occidentalis caurina miRNA (ENSSOCG00000001208.1)
  29. Struthio camelus australis (African ostrich) microRNA let-7a-3 (ENSSCUG00000010996.1)