Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-378c precursor URS000075ABA6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR378C: MIR378C is a member of the miR-378 family and is frequently downregulated in colorectal cancer (CRC) [PMC9263271]. Several studies have evaluated miRNAs, including MIR378C, as potential diagnostic and prognostic biomarkers for sepsis [PMC8358855]. Serum MIR126 has been proposed as a potential candidate biomarker for sepsis, with reduced levels compared to non-infectious conditions [PMC8358855]. The reduced levels of MIR126 and MIRLET7I in plasma of sepsis patients corroborate previous observations in serum samples [PMC8358855]. Host leukocyte miRNAs have also been found to have altered expression in sepsis patients with different causative pathogens, including MIR100, MIR501, MIR99A, MIR483, MIR141, MIR378C, and MIR193B [PMC8358855]. In a study on satellite cells in mice, upregulation of genes promoting cell death (e.g., H19 and Fndc1) and downregulation of genes promoting cell survival (e.g., Dhcr24 and Snord65) were observed in the absence of scERαKO satellite cells compared to scERαWT satellite cells. The upregulated gene H19 is associated with the downregulation of the gene mir378c [PMC6655560]. In gastric cancer patients, low expression levels of MIR378C were observed. This suggests that it has potential as a diagnostic and prognostic indicator for gastric cancer [PMC8017737]. Differentiation status, TNM staging (tumor-node-metastasis staging), and low expression levels of MIR378C were found to be effective independent factors for prognosis in gastric cancer patients [PMC8017737].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGGCCAUCACUGGACUUGGAGUCAGAAGAGUGGAGUCGGGUCAGACUUCAACUCUGACUUUGAAGGUGGUGAGUGCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications