v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Danio rerio (zebrafish) dre-miR-155 secondary structure diagram

Danio rerio (zebrafish) dre-miR-155 URS000075A65A_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAAUGCUAAUCGUGAUAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Anolis carolinensis aca-miR-155-5p
  2. Callithrix jacchus cja-miR-155
  3. Chrysemys picta (Painted turtle) cpi-miR-155a-5p
  4. Cricetulus griseus (Chinese hamster) cgr-miR-155
  5. Cyprinus carpio ccr-miR-155
  6. Gallus gallus (chicken) gga-miR-155
  7. Gorilla gorilla gorilla ggo-miR-155 (MIR155)
  8. Gorilla gorilla (western gorilla) ggo-miR-155
  9. Tor tambroides (Thai mahseer) miR-155
  10. Xenopus tropicalis (tropical clawed frog) xtr-miR-155
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications