Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-197-3p URS000061E740_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-197: Hsa-mir-197 is a microRNA, a small non-coding RNA molecule, which plays a role in the regulation of gene expression [PMC3110257]. In the context of psoriasis, in situ hybridization assays were conducted on skin biopsies to detect the presence of hsa-mir-197 among other microRNAs [PMC3110257]. These assays included samples from psoriatic lesions, uninvolved skin from psoriasis patients, and skin from healthy controls [PMC3110257]. Additionally, hsa-mir-197 was included in a separate set of molecular assays designed to investigate its expression alongside other microRNAs and genes potentially involved in psoriasis [PMC3764000]. The inclusion of hsa-mir-197 in these studies suggests its potential significance in the pathogenesis or molecular pathways associated with psoriatic skin lesions [PMC3764000].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACCACCUUCUCCACCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Ateles geoffroyi age-miR-197
  2. Bos taurus (domestic cattle) bta-miR-197
  3. Callithrix jacchus cja-miR-197
  4. Canis lupus familiaris (dog) cfa-miR-197
  5. Capra hircus (goat) chi-miR-197-3p
  6. Cavia porcellus (domestic guinea pig) cpo-miR-197-3p
  7. Cervus elaphus (red deer) cel-miR-197
  8. Equus caballus eca-miR-197
  9. Gorilla gorilla gorilla ggo-miR-197 (MIR197)
  10. Gorilla gorilla ggo-miR-197
  11. Loxodonta africana (African savanna elephant) Laf-Mir-197_3p (mature (guide))
  12. Macaca mulatta (Rhesus monkey) mml-miR-197-3p
  13. Microcebus murinus (gray mouse lemur) mmr-miR-197
  14. Oryctolagus cuniculus (rabbit) ocu-miR-197-3p
  15. Otolemur garnettii oga-miR-197
  16. Pan paniscus ppa-miR-197
  17. Pan troglodytes ptr-miR-197
  18. Pongo abelii (Sumatran orangutan) Pab-Mir-197_3p (mature (guide))
  19. Pongo pygmaeus ppy-miR-197
Relationships

Molecular Relationships

GoFlow Results Publications