v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1249-3p URS000060AABB_10090

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACGCCCUUCCCCCCCUUCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (domestic cattle) bta-miR-1249
  2. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-1249_3p (mature (guide))
  3. Canis lupus familiaris cfa-miR-1249
  4. Capra hircus (goat) chi-miR-1249
  5. Cervus elaphus (red deer) cel-miR-1249
  6. Cricetulus griseus cgr-miR-1249
  7. Dasypus novemcinctus dno-miR-1249-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1249_3p (mature (guide))
  9. Eptesicus fuscus efu-miR-1249
  10. Equus caballus (horse) Eca-Mir-1249_3p (mature (guide))
  11. Gorilla gorilla gorilla ggo-miR-1249 (MIR1249)
  12. Gorilla gorilla (western gorilla) ggo-miR-1249
  13. Homo sapiens hsa-miR-1249-3p
  14. Macaca mulatta (Rhesus monkey) mml-miR-1249
  15. Microcebus murinus (gray mouse lemur) Mmr-Mir-1249_3p (mature (guide))
  16. Oryctolagus cuniculus (rabbit) ocu-miR-1249-3p
  17. Pan troglodytes ptr-miR-1249
  18. Pongo abelii (Sumatran orangutan) Pab-Mir-1249_3p (mature (guide))
  19. Pongo pygmaeus ppy-miR-1249
  20. Rattus norvegicus rno-miR-1249
  21. Sus scrofa ssc-miR-1249
 Relationships

Molecular Relationships

 Publications