Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR166h-3p URS00005C8AFA_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-mir166c-3p: Zma-miR166c-3p is a member of the miR166 family, a group of microRNAs implicated in the regulation of various genes in plants [PMC4628322]. This miRNA was found to be down-regulated in a dwarf mutant (A1) compared with its corresponding wild type (A9), suggesting its involvement in plant development processes [PMC4628322]. Zma-miR166c-3p, along with other miRNAs from the same family, targets multiple genes including homeobox-leucine zipper proteins and peroxidases, which play roles in plant structure and stress responses [PMC4628322]. Additionally, zma-miR166c-3p is involved in targeting genes responsible for ABA responsive element binding and ribonucleoside-diphosphate reductase subunit M2, which are associated with plant growth regulation and DNA synthesis respectively [PMC4628322]. The gene XPB2 is also predicted to be targeted by zma-miR166c-3p among other miRNAs from the miR166 family, indicating a potential role for this microRNA in DNA repair processes [PMC8472271]. The expression levels of XPB2 were validated for zma-miR166c-3p along with other miRNAs from its family, confirming their regulatory relationship [PMC8472271]. This evidence collectively highlights the significance of zma-miR166c-3p as a regulatory molecule influencing various biological pathways critical to plant development and stress responses.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Arabidopsis thaliana AGO1_0306
  2. Citrus sinensis csi-miR166c-3p
  3. Cucumis melo cme-miR166g
  4. Cynara cardunculus var. scolymus cca-miR166f
  5. Glycine max (soybean) gma-miR166t
  6. Prunus persica microRNA miRNA_264
  7. Sorghum bicolor (sorghum) sbi-miR166j
  8. Theobroma cacao (cacao) tcc-miR166b
Relationships

Molecular Relationships

Publications