v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-99a-3p URS00005C62FC_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAAGCUCGCUUCUAUGGGUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-99a-3p
  2. Anolis carolinensis (green anole) Aca-Mir-10-P2c_3p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-10-P2c_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-10-P2c_3p* (star (passenger))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-10-P2c_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-10-P2c_3p* (star (passenger))
  7. Cavia porcellus (domestic guinea pig) cpo-miR-99a-3p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P2c_3p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-99a-3p
  10. Columba livia (rock pigeon) cli-miR-99-3p
  11. Cricetulus griseus cgr-miR-99a-3p
  12. Dasypus novemcinctus dno-miR-99a-3p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P2c_3p* (star (passenger))
  14. Equus caballus (horse) Eca-Mir-10-P2c_3p* (star (passenger))
  15. Gallus gallus Gga-Mir-10-P2c_3p* (star (passenger))
  16. Gekko japonicus Gja-Mir-10-P2c_3p* (star (passenger))
  17. Latimeria chalumnae (coelacanth) Lch-Mir-10-P2c_3p* (star (passenger))
  18. Loxodonta africana (African savanna elephant) Laf-Mir-10-P2c_3p* (star (passenger))
  19. Macaca mulatta Mml-Mir-10-P2c_3p* (star (passenger))
  20. Microcaecilia unicolor Mun-Mir-10-P2c_3p* (star (passenger))
  21. Microcebus murinus (gray mouse lemur) Mmr-Mir-10-P2c_3p* (star (passenger))
  22. Oryctolagus cuniculus ocu-miR-99a-3p
  23. Pongo abelii (Sumatran orangutan) Pab-Mir-10-P2c_3p* (star (passenger))
  24. Scyliorhinus torazame Sto-Mir-10-P2c_3p* (star (passenger))
  25. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P2c_3p* (star (passenger))
 Relationships

Molecular Relationships

 GoFlow Results Publications