v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-191-5p URS00005C2E31_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-191: Hsa-mir-191 is a microRNA that has been identified as overexpressed in tumors, along with nineteen other microRNAs such as hsa-miR-21, indicating a potential role in tumorigenesis [PMC2133370]. Additionally, hsa-mir-191 has been significantly associated with patient prognosis in esophageal adenocarcinoma (EAC), as determined by survival analysis using the survival R package [PMC6489589]. This association suggests that hsa-mir-191 could serve as a biomarker for predicting the outcome of EAC patients [PMC6489589].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAACGGAAUCCCAAAAGCAGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Alligator mississippiensis Ami-Mir-191_5p (mature (guide))
  2. Anolis carolinensis aca-miR-191-5p
  3. Bos taurus (domestic cattle) bta-miR-191
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-191
  5. Canis lupus familiaris (dog) Cfa-Mir-191_5p (mature (guide))
  6. Cavia porcellus cpo-miR-191-5p
  7. Chrysemys picta bellii Cpi-Mir-191_5p (mature (guide))
  8. Cricetulus griseus (Chinese hamster) cgr-miR-191-5p
  9. Dasypus novemcinctus dno-miR-191-5p
  10. Daubentonia madagascariensis (aye-aye) dma-miR-191
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-191_5p (mature (guide))
  12. Equus caballus eca-miR-191a
  13. Gallus gallus gga-miR-191-5p
  14. Gekko japonicus Gja-Mir-191_5p (mature (guide))
  15. Loxodonta africana (African savanna elephant) Laf-Mir-191_5p (mature (guide))
  16. Macaca mulatta (Rhesus monkey) mml-miR-191-5p
  17. Microcaecilia unicolor Mun-Mir-191_5p (mature (guide))
  18. Microcebus murinus (gray mouse lemur) mmr-miR-191
  19. Monodelphis domestica Mdo-Mir-191_5p (mature (guide))
  20. Mus musculus (house mouse) mmu-miR-191-5p
  21. Nomascus leucogenys nle-miR-191
  22. Notamacropus eugenii (tammar wallaby) Neu-Mir-191_5p (mature (guide))
  23. Ophiophagus hannah (king cobra) oha-miR-191-5p
  24. Ornithorhynchus anatinus Oan-Mir-191_5p (mature (guide))
  25. Oryctolagus cuniculus (rabbit) ocu-miR-191-5p
  26. Otolemur garnettii (small-eared galago) oga-miR-191
  27. Pan paniscus (pygmy chimpanzee) ppa-miR-191
  28. Pan troglodytes (chimpanzee) ptr-miR-191
  29. Papio hamadryas pha-miR-191
  30. Pongo abelii (Sumatran orangutan) Pab-Mir-191_5p (mature (guide))
  31. Pongo pygmaeus (Bornean orangutan) ppy-miR-191
  32. Python bivittatus (Burmese python) pbv-miR-191-5p
  33. Rattus norvegicus (Norway rat) rno-miR-191a-5p
  34. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-191
  35. Sarcophilus harrisii Sha-Mir-191_5p (mature (guide))
  36. Sphenodon punctatus Spt-Mir-191_5p (mature (guide))
  37. Sus scrofa (pig) ssc-miR-191
  38. Xenopus laevis Xla-Mir-191-P2_5p (mature (guide))
  39. Xenopus tropicalis Xtr-Mir-191_5p (mature (guide))
 Relationships

Molecular Relationships

 Publications