Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-16 precursor (ppy-mir-16-1) URS000056BFD0_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000015163.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-16 precursor
  3. Callithrix jacchus microRNA cja-mir-16 precursor (cja-mir-16-1)
  4. Cebus imitator (Panamanian white-faced capuchin) miRNA (ENSCCAG00000003165.1)
  5. Cercocebus atys miRNA (ENSCATG00000017466.1)
  6. Chlorocebus sabaeus miRNA (ENSCSAG00000027360.1)
  7. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000003921.1)
  8. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-16 (ENSGGOG00000030216.2)
  9. Gorilla gorilla (western gorilla) microRNA ggo-mir-16 precursor
  10. Homo sapiens (human) microRNA hsa-mir-16 precursor (hsa-mir-16-1)
  11. Macaca fascicularis (Crab-eating macaque) miRNA (ENSMFAG00000013667.2)
  12. Macaca mulatta microRNA mml-mir-16 precursor (mml-mir-16-1)
  13. Macaca nemestrina microRNA mne-mir-16 precursor
  14. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000015251.1)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA (ENSNLEG00000026414.2)
  16. Pan paniscus microRNA ppa-mir-16 precursor
  17. Pan troglodytes (chimpanzee) microRNA ptr-mir-16 precursor (ptr-mir-16-1)
  18. Papio anubis (olive baboon) miRNA (ENSPANG00000027424.3)
  19. Piliocolobus tephrosceles miRNA (ENSPTEG00000030575.1)
  20. Pongo abelii miRNA (ENSPPYG00000021780.2)
  21. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000010002.1)
  22. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000004053.1)
  23. Saguinus labiatus microRNA sla-mir-16 precursor
  24. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000006446.1)
  25. Theropithecus gelada microRNA 16-1 (ENSTGEG00000004514.1)
Publications