v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-219 URS0000565C8D_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAUUGUCCAAACGCAAUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-219-5p
  2. Branchiostoma floridae bfl-miR-219
  3. Canis lupus familiaris cfa-miR-219-5p
  4. Capitella teleta cte-miR-219
  5. Capra hircus chi-miR-219
  6. Drosophila erecta miR-219-RA
  7. Drosophila melanogaster (fruit fly) dme-miR-219-5p
  8. Drosophila mojavensis miR-219-RA
  9. Drosophila pseudoobscura pseudoobscura miR-219-RA
  10. Drosophila virilis miR-219-RA
  11. Drosophila yakuba miR-219-RA
  12. Equus caballus (horse) eca-miR-219-5p
  13. Gallus gallus (chicken) gga-miR-219a
  14. Gorilla gorilla gorilla ggo-miR-219 (MIR219)
  15. Gorilla gorilla ggo-miR-219
  16. Homo sapiens hsa-miR-219a-5p
  17. Monodelphis domestica mdo-miR-219-5p
  18. Mus musculus mmu-miR-219a-5p
  19. Pan troglodytes (chimpanzee) ptr-miR-219-5p
  20. Pongo pygmaeus ppy-miR-219-5p
  21. Pteropus alecto (black flying fox) pal-miR-219a-5p
  22. Rattus norvegicus (Norway rat) rno-miR-219a-5p
  23. Tribolium castaneum (red flour beetle) tca-miR-219-5p
  24. Xenopus tropicalis xtr-miR-219
 Relationships

Molecular Relationships

 Publications