Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-20a precursor URS0000507C9B_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-20a: Bta-mir-20a is a microRNA that has been identified as a master regulator in various studies [PMC9445238]. It has been found to be downregulated in some cases [PMC9445238], while in other studies it has been identified as one of the highly expressed and constant miRNAs [PMC6691986]. Bta-mir-20a has also been validated as a regulator of PTEN (phosphatase and tensin homolog) in bovine granulosa cells [PMC5602670]. In follicular cells (FCs) derived from follicles with poor oocyte quality, the levels of bta-mir-20a were found to be lower, suggesting reduced activity of the PI3K-Akt signaling pathway [PMC5602670]. Bta-mir-20a, along with other miRNAs such as bta-miR-494, were significantly higher in FCs derived from follicles where oocyte cleavage occurred [PMC5602670]. In another study, bta-mir-20a was found to be differentially expressed in high and low motility fractions of bull spermatozoa [PMC9113469]. Furthermore, bta-mir-20a was among the miRNAs that were differentially expressed during early pregnancy in cattle when analyzed from milk and plasma samples [PMC6418173]. It is worth noting that bta-mir-20a did not follow the same expression trend as other members of its cluster or polycistronic miRNAs such as bta-miR-25 and bta-miR-92 [PMC5325256]. Overall, these studies highlight the importance of bta-mir-20a in various biological processes and its potential role as a regulator.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Ailuropoda melanoleuca microRNA 20a (ENSAMEG00000023283.2)
  2. Aotus nancymaae (Ma's night monkey) microRNA 20a (ENSANAG00000015021.1)
  3. Ateles geoffroyi microRNA age-mir-20 precursor
  4. Capra hircus (Goat) microRNA mir-20a (ENSCHIG00000009259.1)
  5. Cebus imitator (Panamanian white-faced capuchin) microRNA 20a (ENSCCAG00000003025.1)
  6. Cercocebus atys (Sooty mangabey) microRNA 20a (ENSCATG00000020027.1)
  7. Chlorocebus sabaeus (African green monkey) microRNA 20a (ENSCSAG00000025440.1)
  8. Choloepus hoffmanni miRNA (ENSCHOG00000014344.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000009318.1)
  10. Equus caballus microRNA eca-mir-20a precursor
  11. Gorilla gorilla gorilla ggo-mir-20a (ENSGGOG00000032749.2)
  12. Gorilla gorilla microRNA ggo-mir-20a precursor
  13. Homo sapiens microRNA hsa-mir-20a precursor
  14. Lagothrix lagotricha microRNA lla-mir-20 precursor
  15. Macaca mulatta (Rhesus monkey) microRNA mml-mir-20a precursor
  16. Macaca nemestrina microRNA mne-mir-20 precursor
  17. Mandrillus leucophaeus microRNA 20a (ENSMLEG00000015033.1)
  18. Marmota marmota marmota microRNA 20a (ENSMMMG00000021343.1)
  19. Mustela putorius furo microRNA 20a (ENSMPUG00000023481.1)
  20. Myotis lucifugus microRNA 20a (ENSMLUG00000017816.1)
  21. Neogale vison microRNA 20a (ENSNVIG00000016027.1)
  22. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 20a (ENSNLEG00000019456.2)
  23. Ovis aries miRNA (ENSOARG00000025155.1)
  24. Pan paniscus microRNA ppa-mir-20 precursor
  25. Panthera pardus microRNA 20a (ENSPPRG00000014295.1)
  26. Panthera tigris altaica microRNA 20a (ENSPTIG00000002079.1)
  27. Pan troglodytes microRNA ptr-mir-20a precursor
  28. Pongo abelii miRNA
  29. Pongo pygmaeus microRNA ppy-mir-20a precursor
  30. Pteropus vampyrus microRNA 20a (ENSPVAG00000024896.1)
  31. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 20a (ENSRBIG00000009738.1)
  32. Rhinopithecus roxellana microRNA 20a (ENSRROG00000003835.1)
  33. Saguinus labiatus microRNA sla-mir-20 precursor
  34. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 20a (ENSSBOG00000009772.1)
  35. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000003442.1)
  36. Sus scrofa microRNA ssc-mir-20a precursor
  37. Tupaia belangeri (northern tree shrew) microRNA 20a (ENSTBEG00000017955.1)
  38. Tursiops truncatus microRNA 20a (ENSTTRG00000022154.1)
  39. Urocitellus parryii microRNA 20a (ENSUPAG00010007917.1)
  40. Ursus americanus (American black bear) microRNA 20a (ENSUAMG00000023255.1)
  41. Ursus maritimus (Polar bear) microRNA 20a (ENSUMAG00000025288.1)
  42. Ursus thibetanus thibetanus microRNA 20a (ENSUTTG00000000117.1)
  43. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015012883.1)
Publications