v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-99-5p URS0000502116_9258

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACCCGUAGAUCCGAUCUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (domestic cattle) bta-miR-99a-5p
  2. Callithrix jacchus cja-miR-99
  3. Canis lupus familiaris cfa-miR-99a
  4. Capra hircus (goat) chi-miR-99a-5p
  5. Cervus elaphus cel-miR-99a
  6. Cricetulus griseus (Chinese hamster) cgr-miR-99a-5p
  7. Cyprinus carpio ccr-miR-99
  8. Haplochromis burtoni abu-miR-99b
  9. Mus musculus Mus_musculus piRNA piR-mmu-72681
  10. Nomascus leucogenys nle-miR-99a
  11. Ovis aries microRNA miR-99a
  12. Pteropus alecto pal-miR-99a-5p
  13. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63017
  14. Saimiri boliviensis boliviensis sbo-miR-99a
  15. Taeniopygia guttata tgu-miR-99-5p
  16. Tursiops truncatus (common bottlenose dolphin) miR-99a
  17. Xenopus laevis (African clawed frog) xla-miR-99-5p
  18. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3014282
 Relationships

Molecular Relationships

 Publications