v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-98-5p URS00004E0808_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAAGUUGUAUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Anolis carolinensis Aca-Let-7-P2b3_5p (mature (guide))
  2. Ateles geoffroyi (black-handed spider monkey) age-miR-98
  3. Bos taurus (domestic cattle) bta-miR-98
  4. Callithrix jacchus cja-miR-98
  5. Canis lupus familiaris cfa-miR-98
  6. Capra hircus chi-miR-98-5p
  7. Cavia porcellus cpo-miR-98-5p
  8. Cervus elaphus cel-miR-98
  9. Cricetulus griseus (Chinese hamster) cgr-miR-98
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-98-5p
  11. Daubentonia madagascariensis (aye-aye) dma-miR-98
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2b3_5p (mature (guide))
  13. Equus caballus eca-miR-98
  14. Gekko japonicus Gja-Let-7-P2b3_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-98 (MIR98)
  16. Gorilla gorilla (western gorilla) ggo-miR-98
  17. Loxodonta africana (African savanna elephant) Laf-Let-7-P2b3_5p (mature (guide))
  18. Macaca mulatta (Rhesus monkey) mml-miR-98
  19. Microcaecilia unicolor Mun-Let-7-P2b3_5p (mature (guide))
  20. Microcebus murinus (gray mouse lemur) mmr-miR-98
  21. Mus musculus mmu-miR-98-5p
  22. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-98
  23. Ophiophagus hannah oha-miR-98-5p
  24. Ornithorhynchus anatinus (platypus) oan-miR-98
  25. Oryctolagus cuniculus ocu-miR-98-5p
  26. Otolemur garnettii oga-miR-98
  27. Ovis aries miscellaneous RNA
  28. Pan paniscus (pygmy chimpanzee) ppa-miR-98
  29. Pan troglodytes (chimpanzee) ptr-miR-98
  30. Papio hamadryas pha-miR-98
  31. Pongo abelii (Sumatran orangutan) Pab-Let-7-P2b3_5p (mature (guide))
  32. Pongo pygmaeus ppy-miR-98
  33. Pteropus alecto pal-miR-98-5p
  34. Python bivittatus pbv-miR-98-5p
  35. Rattus norvegicus (Norway rat) rno-miR-98-5p
  36. Sphenodon punctatus Spt-Let-7-P2b3_5p (mature (guide))
  37. Sus scrofa (pig) ssc-miR-98
  38. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-98-5p
  39. Tursiops truncatus (common bottlenose dolphin) miR-98
  40. Xenopus laevis (African clawed frog) xla-miR-98-5p
  41. Xenopus tropicalis xtr-miR-98
 Relationships

Molecular Relationships

 Publications