Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4525 URS00004E02F2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4525: Hsa-mir-4525 is a microRNA (miRNA) that has been implicated in various biological processes and diseases. A variant deletion allele can lead to a decreased minimum free energy (MFE) for hsa-mir-4525, suggesting alterations in its stability and possibly its function [PMC3444488]. In the context of SARS-CoV-2 infection, hsa-mir-4525 is significantly upregulated, with a fold change (FC) greater than 100, indicating its potential role in the host response to the virus [PMC8890551]. The nucleotide insertion in the Omicron variant's Spike NTD provides a binding site for several miRNAs, including hsa-mir-4525, which may have implications for viral-host interactions [PMC9721271]. In small cell lung cancer (SCLC), hsa-mir-4525 is involved in regulatory networks with long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs), which can neutralize its negative regulation on target genes such as GAA [PMC9291301]. Hsa-mir-4525 was identified as the most upregulated miRNA in a study on differential expression of miRNAs [PMC8097233], and it was also found to be upregulated in seminal plasma samples from non-azoospermic patients with positive testicular sperm extraction (TESE) results [PMC10051987]. Bioinformatics analysis and mechanistic studies have revealed that hsa-mir-4525 can form a competing endogenous RNA (ceRNA) network with lncRNA FOXP4–AS1 and FOXP4, suggesting complex regulatory interactions involving this miRNA [PMC10083663]. It has shown significant interactions with various lncRNAs based on validated CLIP experiments using DIANA tools [PMC9307901], further highlighting its role in post-transcriptional gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGGAUGUGCAUGCUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships New

Molecular Relationships

Publications