v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3008748 URS00004DFCB1_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGUGCAAUGUUAAAAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus cja-miR-130a
  2. Daubentonia madagascariensis dma-miR-130a
  3. Gorilla gorilla gorilla ggo-miR-130a (MIR130A)
  4. Gorilla gorilla (western gorilla) ggo-miR-130a
  5. Macaca mulatta mml-miR-130a-3p
  6. Macaca nemestrina (pig-tailed macaque) mne-miR-130a
  7. Microcebus murinus mmr-miR-130a
  8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8111206
  9. Nomascus leucogenys nle-miR-130a
  10. Pan paniscus (pygmy chimpanzee) ppa-miR-130a
 Relationships New

Molecular Relationships