v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-214-5p URS00004DAA89_10090

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCCUGUCUACACUUGCUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Alligator mississippiensis ami-miR-214-5p
  2. Anolis carolinensis aca-miR-214-5p
  3. Bos taurus (domestic cattle) Bta-Mir-214-v1_5p* (star (passenger))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-214-v1_5p* (star (passenger))
  5. Canis lupus familiaris (dog) Cfa-Mir-214-v1_5p* (star (passenger))
  6. Capra hircus (goat) chi-miR-214-5p
  7. Cavia porcellus cpo-miR-214-5p
  8. Cervus elaphus (red deer) cel-miR-214*
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_5p* (star (passenger))
  10. Columba livia cli-miR-214-5p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-214-5p
  12. Danio rerio (zebrafish) Dre-Mir-214-P1-v1_5p* (star (passenger))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-214-5p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-214-v1_5p* (star (passenger))
  15. Equus caballus (horse) Eca-Mir-214-v1_5p* (star (passenger))
  16. Gadus morhua (Atlantic cod) Gmo-Mir-214-P1_5p (mature (guide))
  17. Gallus gallus (chicken) Gga-Mir-214-v1_5p* (star (passenger))
  18. Gekko japonicus Gja-Mir-214-v1_5p* (star (passenger))
  19. Homo sapiens (human) hsa-miR-214-5p
  20. Latimeria chalumnae (coelacanth) Lch-Mir-214_5p* (star (passenger))
  21. Lepisosteus oculatus (spotted gar) Loc-Mir-214-v1_5p* (star (passenger))
  22. Macaca mulatta (Rhesus monkey) mml-miR-214-5p
  23. Microcaecilia unicolor Mun-Mir-214_5p (mature (co-guide))
  24. Microcebus murinus (gray mouse lemur) Mmr-Mir-214-v1_5p* (star (passenger))
  25. Monodelphis domestica (gray short-tailed opossum) mdo-miR-214-5p
  26. Monopterus albus (swamp eel) Mal-Mir-214-P1-v1_5p (mature (co-guide))
  27. Ornithorhynchus anatinus (platypus) Oan-Mir-214-v1_5p (mature (co-guide))
  28. Oryctolagus cuniculus (rabbit) ocu-miR-214-5p
  29. Pteropus alecto pal-miR-214-5p
  30. Python bivittatus pbv-miR-214-5p
  31. Rattus norvegicus (Norway rat) Rno-Mir-214-v1_5p* (star (passenger))
  32. Salmo salar ssa-miR-214-5p
  33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-214-v1_5p* (star (passenger))
  34. Scyliorhinus torazame Sto-Mir-214-v1_5p* (star (passenger))
  35. Sphenodon punctatus (tuatara) Spt-Mir-214_5p* (star (passenger))
  36. Sus scrofa (pig) ssc-miR-214-5p
  37. Taeniopygia guttata tgu-miR-214-5p
  38. Tetraodon nigroviridis Tni-Mir-214-P1-v1_5p (mature (guide))
  39. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v1_5p* (star (passenger))
  40. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_5p* (star (passenger))
 Relationships

Molecular Relationships

 Publications