v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cebus imitator (Panamanian white-faced capuchin) microRNA 148a (ENSCCAG00000004264.1) secondary structure diagram

Cebus imitator (Panamanian white-faced capuchin) microRNA 148a (ENSCCAG00000004264.1) URS00004C7B32_2715852

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002611.1)
  2. Carlito syrichta miRNA (ENSTSYG00000021283.2)
  3. Castor canadensis miRNA (ENSCCNG00000014739.1)
  4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000015190.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 148a (ENSCSAG00000020715.1)
  6. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000003929.1)
  7. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000045178.1)
  8. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 148a (ENSGGOG00000032717.2)
  9. Homo sapiens microRNA hsa-mir-148a precursor
  10. Loxodonta africana (African savanna elephant) microRNA 148a (ENSLAFG00000024489.1)
  11. Macaca mulatta (Rhesus monkey) microRNA mml-mir-148a precursor
  12. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004641.1)
  13. Mandrillus leucophaeus miRNA (ENSMLEG00000017165.1)
  14. Microcebus murinus microRNA 148a (ENSMICG00000028617.2)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 148a (ENSNLEG00000019662.2)
  16. Otolemur garnettii miRNA (ENSOGAG00000017248.1)
  17. Pan paniscus microRNA 148a (ENSPPAG00000013293.1)
  18. Pan troglodytes ptr-mir-148a (ENSPTRG00000027798.3)
  19. Pongo abelii (Sumatran orangutan) miRNA
  20. Pongo pygmaeus microRNA ppy-mir-148a precursor
  21. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000011629.1)
  22. Rhinopithecus bieti miRNA (ENSRBIG00000011558.1)
  23. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000005740.1)
  24. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016334.1)
  25. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017891.1)
  26. Urocitellus parryii mir-148a
 2D structure