Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-3000 URS00004BF52E_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-3000: bmo-mir-3000 is a microRNA (miRNA) that has been observed to play a role in the host response to bacterial infection, specifically showing differential expression patterns during infections with Listeria species [PMC5733040]. This miRNA was found to be upregulated in the presence of the pathogenic L. monocytogenes, while it was downregulated when infected with the non-pathogenic L. innocua [PMC5733040]. The upregulation of bmo-mir-3000 during L. monocytogenes infection suggests an active involvement in the host's defensive mechanisms, potentially through the targeting of specific genes such as chitotriosidase-1 [PMC5733040]. The expression patterns of bmo-mir-3000 were found to be in strong agreement with microarray results, reinforcing its significance in response to infection [PMC5733040]. Moreover, quantitative real-time PCR has validated these findings, confirming bmo-mir-3000's role and its reciprocal regulation depending on the pathogenicity of the infecting Listeria strain [PMC5733040]. The inverse expression profile of bmo-mir-3000 during infections with different Listeria species highlights its potential as a biomarker for distinguishing between pathogenic and non-pathogenic infections [PMC5733040].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCUUAGAUGAAGACACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications