v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR167j-5p URS00004B5529_4577

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAAGCUGCCAGCAUGAUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Amborella trichopoda atr-miR167
  2. Ananas comosus microRNA 167h
  3. Arabidopsis thaliana (thale cress) Ath_wt_13786
  4. Asparagus officinalis aof-miR167c
  5. Citrus sinensis (sweet orange) csi-miR167a-5p
  6. Cucumis melo cme-miR167d
  7. Cynara cardunculus var. scolymus cca-miR167b
  8. Digitalis purpurea (common foxglove) dpr-miR167c
  9. Glycine max (soybean) gma-miR167c
  10. Glycine soja (wild soybean) gso-miR167a
  11. Hevea brasiliensis partial microRNA 167a
  12. Linum usitatissimum lus-miR167f
  13. Lotus japonicus lja-miR167
  14. Manihot esculenta mes-miR167a
  15. Medicago truncatula mtr-miR167b-5p
  16. Moringa oleifera (horseradish tree) novel_miR_22
  17. Nicotiana attenuata microRNA mir-167-like
  18. Oryza sativa (Asian cultivated rice) osa-miR167f
  19. Oryza sativa Japonica Group microRNA osa-miR167d-5p
  20. Populus tomentosa Pto-miR167e
  21. Populus trichocarpa ptc-miR167e
  22. Prunus persica (peach) microRNA miRNA_117
  23. Saccharum officinarum (sugarcane) sof-miR167b
  24. Saccharum sp. ssp-miR167b
  25. Sorghum bicolor (sorghum) sbi-miR167e
  26. Vitis vinifera (wine grape) vvi-miR167a
 Relationships

Molecular Relationships

 GoFlow Results Publications