Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-28 precursor URS000048B329_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR28: MIR28 is a type of microRNA that has been shown to repress the expression of ΔVSP-175-myc, IGF1, and MDSC percentage in various experiments [PMC3937270] [PMC7782091]. In one study, the combination of MIR28 and miR83 was found to decrease ΔVSP-175-myc expression to 48%, while the combination of miR86, MIR28, and miR83 decreased expression to 33%, and the combination of miR88, miR86, MIR28, and miR83 decreased expression to 19% [PMC3937270]. In another study using a co-culture system, knockdown of miR21 and miR130b along with overexpression of MIR28 resulted in a significant decrease in IGF1 expression (P = 0.005) and MDSC percentage (P = 0.005) [PMC7782091]. These findings suggest that MIR28 plays a role in regulating the expression of various genes involved in different biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCCUUGCCCUCAAGGAGCUCACAGUCUAUUGAGUUACCUUUCUGACUUUCCCACUAGAUUGUGAGCUCCUGGAGGGCAGGCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications