v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR535-5p URS0000464D75_39947

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGACAACGAGAGAGAGCACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Amborella trichopoda atr-miR535
  2. Asparagus officinalis aof-miR535
  3. Carica papaya cpa-miR535
  4. Eugenia uniflora (Brazil-cherry) eun-miR535a-5p
  5. Malus domestica mdm-miR535a
  6. Moringa oleifera (horseradish tree) novel_miR_177
  7. Oryza sativa (Asian cultivated rice) osa-miR535-5p
  8. Physcomitrium patens ppt-miR535a
  9. Picea abies pab-miR535a
  10. Prunus persica ppe-miR535a
  11. Ricinus communis (castor bean) rco-miR535
  12. Vitis vinifera vvi-miR535b
 Relationships

Molecular Relationships