Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-199a precursor (hsa-mir-199a-2) URS000043F622_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR199A2: MIR199A2 is a gene located on chromosome 1 that encodes for a microRNA [PMC3281082]. It is one of the MIRs that regulate the expression of anti-apoptotic genes and is frequently found in regions altered in cancer [PMC2683874]. The promoter region of MIR199A2 has been analyzed and cloned into a vector for further study [PMC3668635]. It has been found to be consistently upregulated or downregulated in different passages of cells [PMC6694630]. MIR199A2 has also been found to be differentially methylated in a pilot study [PMC4446486]. It is located within the intron region of the DNM3OS gene [PMC8326843]. The expression of MIR199A2 has been inversely correlated with miR23B and its differential regulation at the transcriptional level has been suggested in ovarian cancer cells [PMC5814174] [PMC2889129]. In Alzheimer's disease, MIR199A2 has been found to be upregulated, along with other miRNAs such as MIR129-2, MIR219A1, and MIR92A1, while other miRNAs like MIR1296 and MIR431 are downregulated [PMC7564652]. The dysregulation of these miRNAs may play a role in AD pathology. In addition, it has been identified as one of the top 10 miRNAs with the highest absolute amount in certain contexts [PMC8010072]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Aotus nancymaae miRNA (ENSANAG00000013519.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000042250.2)
  3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000018096.1)
  4. Chlorocebus sabaeus microRNA 199a-2 (ENSCSAG00000020384.1)
  5. Colobus angolensis palliatus miRNA (ENSCANG00000038104.1)
  6. Gorilla gorilla gorilla ggo-mir-199a (ENSGGOG00000033976.2)
  7. Gorilla gorilla microRNA ggo-mir-199a precursor
  8. Macaca fascicularis (Crab-eating macaque) microRNA 199a-2 (ENSMFAG00000012003.2)
  9. Macaca mulatta microRNA mml-mir-199a precursor (mml-mir-199a-1)
  10. Macaca nemestrina microRNA mne-mir-199a precursor
  11. Mandrillus leucophaeus miRNA (ENSMLEG00000013365.1)
  12. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 199a-2 (ENSNLEG00000023217.2)
  13. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-199a precursor
  14. Pan troglodytes microRNA ptr-mir-199a precursor (ptr-mir-199a-2)
  15. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000015303.1)
  16. Pongo abelii (Sumatran orangutan) microRNA 199a-2 (ENSPPYG00000021109.2)
  17. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-199a precursor
  18. Prolemur simus (greater bamboo lemur) microRNA 199a-2 (ENSPSMG00000008030.1)
  19. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000008656.1)
  20. Rhinopithecus bieti miRNA (ENSRBIG00000008477.1)
  21. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 199a-2 (ENSRROG00000002905.1)
  22. Saguinus labiatus microRNA sla-mir-199a precursor
  23. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 199a-2 (ENSSBOG00000017075.1)
  24. Theropithecus gelada microRNA 199a-2 (ENSTGEG00000004928.1)
Publications