v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR399c URS00003CFBD5_3847

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCCAAAGGAGAGUUGCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Ananas comosus microRNA 399b
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR399c-3p
  3. Arabidopsis thaliana (thale cress) ath-miR399c-3p
  4. Asparagus officinalis aof-miR399a
  5. Citrus sinensis csi-miR399d-3p
  6. Corchorus olitorius aly-miR399a-
  7. Fragaria vesca subsp. vesca fve-miR399a
  8. Helianthus annuus (common sunflower) ath-miR399b
  9. Malus domestica mdm-miR399i
  10. Manihot esculenta mes-miR399f
  11. Medicago truncatula mtr-miR399l
  12. Mus musculus (house mouse) rco-miR399a
  13. Oryza sativa (Asian cultivated rice) osa-miR399d
  14. Oryza sativa Japonica Group microRNA osa-miR399d
  15. Phaseolus vulgaris (string bean) pvu-miR399a
  16. Picea abies (Norway spruce) pab-miR399d
  17. Ricinus communis (castor bean) rco-miR399a
  18. Sorghum bicolor (sorghum) sbi-miR399d
  19. Theobroma cacao (cacao) tcc-miR399i
  20. Vigna unguiculata vun-miR399a
  21. Vitis vinifera vvi-miR399b
  22. Zea mays (maize) zma-miR399e-3p
 Relationships

Molecular Relationships

 Publications